• Users Online: 404
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
SHORT COMMUNICATION
Year : 2019  |  Volume : 21  |  Issue : 2  |  Page : 100-103

Low incidence and the prevalence of brucellosis among patients with pyrexia of unknown origin based on real-time polymerase chain reaction, enzyme-linked immunosorbent assay and standard agglutination test results in Puducherry, South India


1 Department of Microbiology, Sri Manakula Vinayagar Medical College and Hospital, Puducherry, India
2 Department of Clinical Immunology, Jawaharlal Institute of Postgraduate Medical Education and Research, Puducherry, India
3 Department of Microbiology, Jawaharlal Institute of Postgraduate Medical Education and Research, Puducherry, India

Date of Submission09-Jul-2019
Date of Decision30-Sep-2019
Date of Acceptance29-Nov-2019
Date of Web Publication17-Jan-2020

Correspondence Address:
Dr. Harish Belgode Narasimha
Department of Microbiology, Jawaharlal Institute of Postgraduate Medical Education and Research, Puducherry - 605 006
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jacm.jacm_15_19

Rights and Permissions
  Abstract 


CONTEXT: Brucellosis is a zoonotic disease and an important differential to be considered in patients with pyrexia of unknown origin (PUO). The laboratory diagnosis of brucellosis has always been affected by various factors such as the slow growth of the organism and cross-reacting antibodies. Hence, a diagnostic test with high sensitivity and specificity is the key for the accurate and rapid diagnosis.
AIM: The study aimed to evaluate the role of real-time polymerase chain reaction (PCR) in the rapid diagnosis of human brucellosis from direct serum samples of patients with PUO.
MATERIALS AND METHODS: An observational study was conducted from October 2014 to September 2016 at a tertiary care hospital in Puducherry where 138 blood samples were obtained from the patients with PUO. Serum separated from each sample was tested for brucellosis using Cobas 480 Z real-time PCR system. Simultaneously, the samples were also subject to blood culture, standard agglutination test (SAT) and enzyme-linked immunosorbent assay (ELISA) (IgG and IgM) for brucellosis.
RESULTS: All the samples were found to be negative for brucellosis using real-time PCR. Blood culture also did not yield any growth of Brucella spp. Among the serological tests, all the samples were negative by SAT, whereas two were positive for IgM and four for IgG anti-Brucella antibodies using ELISA.
CONCLUSION: Brucellosis is not a common cause of PUO among patients attending this hospital since all the samples were negative by highly sensitive and specific tests such as real-time PCR and blood culture. This study highlights the limitations of serological tests such as ELISA in the accurate diagnosis of brucellosis.

Keywords: Human brucellosis, pyrexia of unknown origin, real-time polymerase chain reaction


How to cite this article:
Ranganathan U, Bhaskar M M, Narasimha HB. Low incidence and the prevalence of brucellosis among patients with pyrexia of unknown origin based on real-time polymerase chain reaction, enzyme-linked immunosorbent assay and standard agglutination test results in Puducherry, South India. J Acad Clin Microbiol 2019;21:100-3

How to cite this URL:
Ranganathan U, Bhaskar M M, Narasimha HB. Low incidence and the prevalence of brucellosis among patients with pyrexia of unknown origin based on real-time polymerase chain reaction, enzyme-linked immunosorbent assay and standard agglutination test results in Puducherry, South India. J Acad Clin Microbiol [serial online] 2019 [cited 2020 Feb 21];21:100-3. Available from: http://www.jacmjournal.org/text.asp?2019/21/2/100/276118




  Introduction Top


 Brucellosis More Details is usually a disease affecting animals and is an important health problem worldwide. It is highly endemic in most parts of the Mediterranean littoral, Arabian Peninsula, South America and Central Asia. The prevalence rate of human brucellosis in certain countries has been reported to be more than 10/100,000, but still the true prevalence in most of the countries is unknown due to deficiencies in the diagnosis and reporting.[1] Brucellosis is also an important health problem in India. As 80% of the Indian population live in the rural and suburban areas, the risk of acquiring this zoonotic infection is high due to close contact with animals. Brucellosis in humans is mostly occupational but can also be transmitted by the ingestion of infected milk and milk products. Infected individuals have diverse clinical features, the most common presentation being an acute febrile illness.[2] Various studies have also shown that the prevalence of brucellosis ranges between 0.8% and 6.8% among patients with PUO.[3],[4],[5] The diagnosis of brucellosis is often challenging because of diverse clinical presentations and mostly rely on the laboratory diagnosis. Routine microbiological diagnosis such as the isolation of bacteria in culture and serological tests has major limitations, and many polymerase chain reactions (PCRs)-based methods introduced recently have shown to overcome these limitations.[6]

Only a very few studies based on PCR are done on direct patient samples. This study intends to evaluate the role of real-time PCR in the rapid diagnosis of brucellosis along with other methodologies such as culture, standard agglutination test (SAT) and enzyme-linked immunosorbent assay (ELISA) on serum samples of patients with pyrexia of unknown origin (PUO).


  Materials and Methods Top


The present study was conducted following approval from the Institutional Ethics Committee, and informed written consent was obtained from all the participants of the study. This is an observational study conducted at a tertiary care hospital in Puducherry which included 138 patients with PUO admitted in the hospital over a study period of two years from October 2014 to September 2016. Patients with definitive diagnostic evidence for other infectious etiologies such as malaria, filaria, typhoid, typhus, dengue, influenza, viral hepatitis and others were excluded from the study. The aim of the study was to assess the role of real-time PCR in the rapid diagnosis of human brucellosis from the direct serum samples of patients with PUO. The secondary objective was to compare the results of real-time PCR with other methodologies such as culture, SAT and ELISA. Sample collection – Under sterile aseptic precautions, 10–20 ml of venous blood was collected and one portion (10ml) was used for culture and the serum separated from the remaining sample was used for serological tests and real-time PCR. For real-time PCR, serum samples were stored at −20°C until further analysis. Blood culture – About 10 ml of venous blood was inoculated into the BACTEC bottles and loaded into the BACTEC 9120 system (BD). Samples negative after one week of incubation were further incubated at 37°C for one more week and blind subcultures were performed onto blood agar and MacConkey agar. SAT – Tube method of the SAT was performed following the manufacturer's instructions using a ready-made antigenic suspension, BRUCEL-A containing killed, stained and standardised smooth cell antigens of  Brucella More Details abortus procured from Tulip diagnostics private limited, Goa, India. ELISA – separate ELISA kits detecting IgM antibodies and IgG antibodies against Brucella antigens were procured from NovaTec Immunodiagnostica GmbH, Germany. The principle and procedure of both the kits were essentially the same. The test was performed according to the manufacturer's instructions. Real-time PCR – For the detection of Brucella spp., we targeted a 207 bp fragment conserved region of bcsp 31 gene, encoding a 31 kDa immunogenic membrane protein of B. abortus. This region is specific to the Brucella genus and is present in all biovars. DNA was extracted from the serum using high-pure PCR template preparation kit supplied by Roche diagnostics GmbH, Germany. All steps of the DNA extraction were performed according to the manufacturer's instructions. This TaqMan probe-based assay was done using primers and probes procured from TIB MOLBIOL, Berlin, Germany. The primers used for amplification were as per Queipo-Ortuno et al. as follows:[7] Forward primer (5“-3”) – GGCTCGGTTGCCAATATCAAT, Reverse primer – (5“-3”) GTCTGCGACCGATTTGATGT and Probe (5“FAM-3”BBQ) ATCAAG TCGGGCGCTCTGGAGT. Real-time PCR was performed using the Cobas 480 Z System, Roche Molecular Diagnostics, Germany. Each 20 μl reaction volume included 10 μl of 2x master mix and 2 μl of template DNA. Primers and probe (8 μl) were used at a final concentration of 0.6 μm and 0.2 μm, respectively.

Kit provided positive and negative controls as well as internal controls were used for all the diagnostic tests. For real-time PCR, the bcsp 31 gene from B. abortus S19 strain was used as internal positive control.


  Results Top


A total of 138 patients with PUO were included in this study. The majority of the participants belonged to 21–30 years' (21.7%) group and 41–50 years' (21.7%) group. The mean age was 33 years, and the male-to-female ratio was 1.3: 1. Most of them (39.1%) were farmers by occupation [Graph 1]. While most of the patients (81.9%) did not have any identifiable risk factors, few (18.1%) had at least one identifiable risk factor for brucellosis [Table 1]. SAT: at a diagnostic titre of 1 in 160 dilutions, all the samples were negative for brucellosis by SAT. ELISA: totally six samples were positive for anti-Brucella antibodies by ELISA. IgM anti-Brucella antibodies were positive in two patients and IgG anti-Brucella antibodies were positive in four patients and none were positive for both. Both the patients positive by IgM ELISA were male and had no identifiable risk factors for brucellosis. Among the four patients who were positive for IgG anti-Brucella antibodies, three were male, one was female and two were farmers by occupation. Blood culture – blood culture using the BACTEC 9120 system did not detect any growth even after two weeks of incubation. Real-time PCR – all the serum samples were found to be negative for bcsp 31.

Table 1: Distribution of individual risk factors (n=138)

Click here to view


One patient tested positive by IgG ELISA and also had an antibody titre of 1 in 80 dilutions by SAT. He was a farmer rearing cattle for more than 25 years and a repeat sample from the patient did not show any rise in antibody titres. The results of the various diagnostic tests are depicted in [Graph 2].




  Discussion Top


Blood culture of all the 138 samples did not yield any growth of Brucella even after employing an extended incubation period of two weeks duration. Although previous studies have shown that the overall sensitivity of blood culture varies hugely between 53% and 90%, few studies have shown a superior sensitivity of around 95% for automated detection methods such as BACTEC 9000 series.[8]

At a diagnostic titre of 1 in 160 dilutions, none of the samples were positive for brucellosis by SAT. Studies have shown a sensitivity of 95.6% and specificity of 100.0% for SAT in culture-positive patients.[9] The fact that SAT is a good sensitive test for brucellosis is also highlighted in many other studies.[10],[11]

In this study, two patients were positive by IgM ELISA and four patients were positive by IgG ELISA. None of the patients were positive by both IgG and IgM ELISA. Patients positive by ELISA were negative by other tests such as the SAT, blood culture and real time-PCR. One patient had a titre of 1 in 80 dilutions by SAT who was also positive for anti-Brucella IgG antibodies by ELISA, but blood culture and real-time PCR were negative. The patient was a farmer who was raising cattle for more than 25 years. A repeat sample from the patient, however, did not show any rise in antibody titre in SAT. Repeated subclinical exposures resulting in seroconversion could be a possibility in this patient. The sensitivity and specificity of ELISA have been reported variably in different studies. While few studies show good sensitivity and specificity for both IgM and IgG ELISA (95% and 100% for IgM ELISA and 99% and 84% for IgG ELISA, respectively), few other studies show conflicting results unfavouring ELISA to be a superior test than SAT.[12],[13] Moreover, CDC's Council of State and Territorial Epidemiologists has stated that the case definition for laboratory diagnosis for Brucella does not include non-agglutination based tests such as ELISA as it was associated with false-positive reporting of brucellosis.[14]

All 138 samples were also negative for Brucella species in this study. Previous studies have already established that PCR is a very sensitive test for the diagnosis of brucellosis and even very low levels of DNA can be detected.[15],[16] A high sensitivity and specificity varying between 88%–93.5% and 98.4%–100%, respectively, have also been described for Taqman-based real time-PCR assays for brucellosis.[7],[17]


  Conclusion Top


The objective to establish real-time PCR as a rapid diagnostic tool for the diagnosis of brucellosis from the serum sample of patients could not be achieved since all the samples tested were negative for brucellosis by real-time PCR. Nevertheless, the negative results in real-time PCR along with negative results in specific tests such as blood culture suggest that brucellosis is not a common cause of PUO among patients attending this hospital. As the positive results in ELISA did not correlate with the results of blood culture and real-time PCR, it can also be emphasised that the treatment of brucellosis based on the results of serological tests alone should be discouraged and a combination of tests has to be done.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV. The new global map of human brucellosis. Lancet Infect Dis 2006;6:91-9.  Back to cited text no. 1
    
2.
Food and Agriculture Organization of the United Nations, World Health Organization & World Organisation for Animal Health. Brucellosis in humans and animals. 2006. Available from: https://apps.who.int/iris/handle/10665/43597. [Last accessed 2019 December 13].  Back to cited text no. 2
    
3.
Handa R, Singh S, Singh N, Wali JP. Brucellosis in north India: Results of a prospective study. J Commun Dis 1998;30:85-7.  Back to cited text no. 3
    
4.
Sen MR, Shukla BN, Goyal RK. Seroprevalence of brucellosis in and around Varanasi. J Commun Dis 2002;34:226-7.  Back to cited text no. 4
    
5.
Kadri SM, Rukhsana A, Laharwal MA, Tanvir M. Seroprevalence of brucellosis in Kashmir (India) among patients with pyrexia of unknown origin. J Indian Med Assoc 2000;98:170-1.  Back to cited text no. 5
    
6.
Mitka S, Anetakis C, Souliou E, Diza E, Kansouzidou A. Evaluation of different PCR assays for early detection of acute and relapsing brucellosis in humans in comparison with conventional methods. J Clin Microbiol 2007;45:1211-8.  Back to cited text no. 6
    
7.
Queipo-Ortuño MI, Colmenero JD, Bravo MJ, García-Ordoñez MA, Morata P. Usefulness of a quantitative real-time PCR assay using serum samples to discriminate between inactive, serologically positive and active human brucellosis. Clin Microbiol Infect 2008;14:1128-34.  Back to cited text no. 7
    
8.
Yagupsky P. Detection of Brucellae in blood cultures. J Clin Microbiol 1999;37:3437-42.  Back to cited text no. 8
    
9.
Memish ZA, Almuneef M, Mah MW, Qassem LA, Osoba AO. Comparison of the Brucella standard agglutination test with the ELISA IgG and IgM in patients with Brucella bacteremia. Diagn Microbiol Infect Dis 2002;44:129-32.  Back to cited text no. 9
    
10.
Welch RJ, Litwin CM. A comparison of Brucella IgG and IgM ELISA assays with agglutination methodology. J Clin Lab Anal 2010;24:160-2.  Back to cited text no. 10
    
11.
Mert A, Ozaras R, Tabak F, Bilir M, Yilmaz M, Kurt C, et al. The sensitivity and specificity of Brucella agglutination tests. Diagn Microbiol Infect Dis 2003;46:241-3.  Back to cited text no. 11
    
12.
Araj GF, Kattar MM, Fattouh LG, Bajakian KO, Kobeissi SA. Evaluation of the PANBIO Brucella immunoglobulin G (IgG) and IgM enzyme-linked immunosorbent assays for diagnosis of human brucellosis. Clin Diagn Lab Immunol 2005;12:1334-5.  Back to cited text no. 12
    
13.
Gómez MC, Nieto JA, Rosa C, Geijo P, Escribano MA, Muñoz A, et al. Evaluation of seven tests for diagnosis of human brucellosis in an area where the disease is endemic. Clin Vaccine Immunol 2008;15:1031-3.  Back to cited text no. 13
    
14.
Centers for Disease Control and Prevention (CDC). Public health consequences of a false-positive laboratory test result for Brucella-Florida, Georgia, and Michigan, 2005. MMWR Morb Mortal Wkly Rep 2008;57:603-5.  Back to cited text no. 14
    
15.
Romero C, Gamazo C, Pardo M, López-Goñi I. Specific detection of Brucella DNA by PCR. J Clin Microbiol 1995;33:615-7.  Back to cited text no. 15
    
16.
Al-Attas RA, Al-Khalifa M, Al-Qurashi AR, Badawy M, Al-Gualy N. Evaluation of PCR, culture and serology for the diagnosis of acute human brucellosis. Ann Saudi Med 2000;20:224-8.  Back to cited text no. 16
    
17.
Surucuoglu S, El S, Ural S, Gazi H, Kurutepe S, Taskiran P, et al. Evaluation of real-time PCR method for rapid diagnosis of brucellosis with different clinical manifestations. Pol J Microbiol 2009;58:15-9.  Back to cited text no. 17
    



 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Tables

 Article Access Statistics
    Viewed89    
    Printed4    
    Emailed0    
    PDF Downloaded1    
    Comments [Add]    

Recommend this journal