• Users Online: 342
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
CASE REPORT
Year : 2018  |  Volume : 20  |  Issue : 2  |  Page : 111-113

Late-onset sepsis by Achromobacter xylosoxidans in a healthy neonate


1 Department of Microbiology, Government T D Medical College, Alappuzha, Kerala, India
2 Department of Paediatrics, Government T D Medical College, Alappuzha, Kerala, India

Date of Web Publication7-Jan-2019

Correspondence Address:
Dr. Arun Sachu
Department of Microbiology, Government T D Medical College, Alappuzha - 688 005, Kerala
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jacm.jacm_7_18

Rights and Permissions
  Abstract 


Achromobacter xylosoxidans is a rare pathogen in clinical settings. Infections are reported infrequently in immunocompromised neonates. We report a case of late-onset sepsis in a 28-day-old neonate whose cerebrospinal fluid and blood culture grew A. xylosoxidans

Keywords: Achromobacter xylosoxidans, meningitis, neonate, septicaemia


How to cite this article:
Madhavan A, Sachu A, Vasudevapanicker J, Balakrishnan S, Sreelatha P R. Late-onset sepsis by Achromobacter xylosoxidans in a healthy neonate. J Acad Clin Microbiol 2018;20:111-3

How to cite this URL:
Madhavan A, Sachu A, Vasudevapanicker J, Balakrishnan S, Sreelatha P R. Late-onset sepsis by Achromobacter xylosoxidans in a healthy neonate. J Acad Clin Microbiol [serial online] 2018 [cited 2019 Aug 18];20:111-3. Available from: http://www.jacmjournal.org/text.asp?2018/20/2/111/249576




  Introduction Top


Alcaligenes xylosoxidans, also known as Achromobacter xylosoxidans, is a Gram-negative, waterborne organism that causes healthcare-associated infections[1],[2] and bacteraemia in immunocompromised patients with indwelling catheters.[3],[4] A. xylosoxidans is found in soil and water and grows in saline.[5] Patients recover bacteriologically indicating low virulence. A. xylosoxidans can be confused with other non-fermenting Gram-negative bacteria, especially pseudomonas spp. However, identification of this organism is of clinical importance as A. xylosoxidans is usually multidrug resistant and the source of infection needs to be pursued.


  Case Report Top


A 28-day-old neonate presented to the paediatric department with the complaints of fever, abnormal cry and poor feeding. The antenatal period was uneventful, with full-term vaginal delivery from outside hospital. On 26th-post-natal day, the neonate developed abdominal distension, for which she was treated by a homeo doctor.

The child was given homeo medicines diluted in water thrice a day, following which she developed fever and abnormal cry. There was no history of seizures. Investigations revealed mild anaemia (Hb 18.2 g/dL) and raised C-reactive protein (28 mg/dL). platelet count, leucocyte count and bilirubin levels were normal. A provisional diagnosis of late-onset sepsis was made and treatment initiated with Amikacin and Cefotaxime.

Cerebrospinal fluid (CSF) protein was 71.2 mg% and sugar 78 mg%. Gram stain of centrifuged deposits showed 2–4/cm2 pus cells and faint staining Gram-negative bacilli. Normal ranges for this age for cells, protein and glucose are 4.5 cells/cm3, 77.6 mg% and 67 mg%, respectively. The corresponding serum glucose level was 45 mg/dL.

CSF was inoculated on blood agar and MacConkey agar. MacConkey agar showed small non-lactose-fermenting colonies and blood agar showed 1–2 mm, round, moist, grey, smooth, entire edge, non-haemolytic colonies after overnight incubation at 37°C. Gram-stained smear showed Gram-negative bacilli, which were oxidase and catalase positive. Conventional blood culture also yielded the same isolate within 48 h of incubation.

A presumptive identification of pseudomonas spp. was made as the biochemical reactions were coinciding with that of pseudomonas spp. (citrate – utilised, nitrate – reduced, urea – not hydrolysed and sugars – not fermented). The growth was subjected to identification by automated VITEK® 2 Compact (C) system version: 06.01 (bioMérieux, North Carolina/USA) using GNID 21-341 and antibiotic susceptibility was done using AST-N 281 card. The organism was identified as Cupriavidus pauculus (98.9% – excellent identification). Antimicrobial susceptibility testing (Vitek 2) showed that the strains were susceptible to Co-trimoxazole, Ceftazidime, Cefepime, Piperacillin-Tazobactam and Meropenem and were resistant to Amikacin and Gentamicin. In spite of the treatment, fever continued to persist. Piperacillin-Tazobactam and Meropenem were added after stopping Amikacin and Cefotaxime. Clinical and microbiological resolution was achieved after starting Meropenem. The isolate was further identified as A. xylosoxidans by PCR amplification and bidirectional sequencing (molecular diagnostics laboratory, AIMS, Kochi, Primer Sequence Eubac U1 F 5' TTGGAGAGTTTGATCCTGGCTC 3'Eubac rU 4 R 5' GGACTACCAGGGTATCTAA 3').


  Discussion Top


A. xylosoxidans is a non-fermentative, Gram-negative bacillus which is widely distributed in nature, especially in aquatic environments. It was first described by Yabuuchi and Ohyama in 1971 from purulent ear discharge of patients with chronic otitis media.[6] A. xylosoxidans has two subspecies: xylosoxidans and denitrificans, the former of which is the most common cause of clinically recognisable infection.[7] A. xylosoxidans may be part of the gastrointestinal and respiratory tracts of some people. It has been recovered from aquatic surroundings in hospitals such as ventilators, humidifiers, sterile saline, intravenous fluids and irrigation and dialysis solutions. They have also been recovered from infant formula, children's soap bubbles, well water and swimming pools. These organisms survive many disinfectants and have been cultured from chlorhexidine, 1% eosin, alcohol and quaternary amine-containing compounds.[1],[8] Originally considered commensals, they are increasingly being recognised as important, although rare, hospital pathogens. Outbreaks of infection have been reported in hospitals including neonatal intensive care units. Nosocomial infections occur in association with immunosuppression, malignancies, HIV infection and neonates.[9]

A. xylosoxidans bacteraemia is almost always a nosocomial infection.[10] Septicaemia caused by this organism is rare, occurs usually in immunocompromised hosts and neonates. We report the first case of A. xylosoxidans causing concomitant meningitis and septicaemia in a healthy neonate from India. Most neonatal infections are nosocomial; vertical transmission from mother to baby has been described. Community-acquired infections are rare and occur mainly in patients with cystic fibrosis. A. xylosoxidans can be confused phenotypically with other non-fermenting Gram-negative bacteria, especially pseudomonas spp. Species-level identification of achromobacter spp. is difficult and isolates are frequently misidentified even by automated identification systems.[11] Therefore, only molecular analysis can give confirmatory results. At present, the genus comprises 19 validly named species,[12] and the clinical importance of different achromobacter spp. has not been comprehensively studied. The source of infection in our case could not be ascertained as surveillance cultures could not be done since the patient was referred from another hospital.

The mortality rate of neonatal infections ranges from 13% to 75%; hence, paediatricians should be aware of this organism. achromobacter spp. typically is resistant to a large number of antibiotics, including Ampicillin, Aztreonam, Aminoglycosides, first- and second-generation Cephalosporins, Tetracyclines and Rifampicin. Most are sensitive in vitro to Trimethoprim-Sulphamethoxazole, Imipenem and in some cases to Ceftazidime, Piperacillin and Cefoperazone. Antimicrobial susceptibility profile for each case should be taken into account for determining the therapy. Although the isolate showed in vitro susceptibility to Piperacillin-Tazobactam, our patient clinically responded to Meropenem 120 mg IV eight hourly for 14 days. The child became symptomatically better and was discharged with review after one week. No similar cases were reported from the hospital by the same isolate

A. xylosoxidans is a rare isolate which should be considered as a pathogen in neonates and immmunocompromised setting that can be completely cured if identified and treated appropriately. The next important thing that we would like to highlight is the misidentification of this isolate for common pathogens such as pseudomonas spp. whose sensitivity report will be entirely different. And at last but not the least, the importance of molecular analysis of the isolate for final identification is also a diagnostic breakthrough.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Reverdy ME, Freney J, Fleurette J, Coulet M, Surgot M, Marmet D, et al. Nosocomial colonization and infection by Achromobacter xylosoxidans. J Clin Microbiol 1984;19:140-3.  Back to cited text no. 1
    
2.
Duggan JM, Goldstein SJ, Chenoweth CE, Kauffman CA, Bradley SF. Achromobacter xylosoxidans bacteremia: Report of four cases and review of the literature. Clin Infect Dis 1996;23:569-76.  Back to cited text no. 2
    
3.
Aisenberg G, Rolston KV, Safdar A. Bacteremia caused by Achromobacter and Alcaligenes species in 46 patients with cancer (1989-2003). Cancer 2004;101:2134-40.  Back to cited text no. 3
    
4.
Shie SS, Huang CT, Leu HS. Characteristics of Achromobacter xylosoxidans bacteremia in Northern Taiwan. J Microbiol Immunol Infect 2005;38:277-82.  Back to cited text no. 4
    
5.
Granowitz EV, Keenholtz SL. A pseudoepidemic of Alcaligenes xylosoxidans attributable to contaminated saline. Am J Infect Control 1998;26:146-8.  Back to cited text no. 5
    
6.
Yabuuchi E, Yano I, Goto S, Tanimura E, Ito T, Ohyama A. Description of Achromobacter xylosoxidans Yabuuchi and Ohyama 1971. Int J Syst Bacteriol 1974;24:470-7.  Back to cited text no. 6
    
7.
Yabuchi E, Kaneko T, Yano I. The nonfermentative gram-negative bacilli. Organisms that are motile with peritrichous flagella. In: Koneman's Color Atlas and Textbook of Diagnostic Microbiology. 6th ed., Ch. 7. wolters kluwer: Baltimore, 2006. p. 340.  Back to cited text no. 7
    
8.
Kumar A, Ray P, Kanwar M, Sethi S, Narang A. Investigation of hospital-acquired infections due to Achromobacter xylosoxidans in a tertiary care hospital in India. J Hosp Infect 2006;62:248-50.  Back to cited text no. 8
    
9.
Giacoia GP. Achromobacter xylosoxidans: A drug-resistant pathogen in newborns and immunocompromised patients. South Med J 1990;83:1312-4.  Back to cited text no. 9
    
10.
Kidd TJ, Ramsay KA, Hu H, Bye PT, Elkins MR, Grimwood K, et al. Low rates of Pseudomonas aeruginosa misidentification in isolates from cystic fibrosis patients. J Clin Microbiol 2009;47:1503-9.  Back to cited text no. 10
    
11.
Gómez-Cerezo J, Suárez I, Ríos JJ, Pena P, Garcia de Miguel MJ, Jose de M, et al. Achromobacter xylosoxidans bacteremia: A 10-year analysis of 54 cases. Eur J Clin Microbiol Infect Dis 2003;22:360-3.  Back to cited text no. 11
    
12.
Vandamme PA, Peeters C, Inganäs E, Cnockaert M, Houf K, Spiker T, et al. Taxonomic dissection of Achromobacter denitrificans Coenye et al. 2003 and proposal of Achromobacter agilis sp. nov., nom. rev., Achromobacter pestifer sp. nov., nom. rev., Achromobacter kerstersii sp. nov. and Achromobacter deleyi sp. nov. Int J Syst Evol Microbiol 2016;66:3708-17.  Back to cited text no. 12
    




 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Case Report
Discussion
References

 Article Access Statistics
    Viewed413    
    Printed46    
    Emailed0    
    PDF Downloaded7    
    Comments [Add]    

Recommend this journal